GoldBamboo.com - Knowledge is strong medicine
  

ACE Gene Polymorphism and ARDS Outcome - Article


  Not Signed In - Sign In / Register


Get Your Free Credit Report Right Now!

Zip Code:






ACE

 




Clinical Trial: ACE Gene Polymorphism and ARDS Outcome

This study has been completed.

Sponsored by: National Taiwan University Hospital
Information provided by: National Taiwan University Hospital
ClinicalTrials.gov Identifier: NCT00155779

Purpose

The acute respiratory distress syndrome (ARDS) is an important cause of acute respiratory failure with a high mortality rate. The mechanism of resolution of the late organizing phase remains uncertain. The ACE gene contains a polymorphism based on the presence (insertion, I) or absence (deletion, D) within an intron of a 287-bp nonsense DNA domain, resulting in three genotypes (DD and II homozygotes, and ID heterozygotes). It has been shown that I/D polymorphism of ACE gene may account for half the variance of serum ACE levels in the Caucasians. Polymorphism of the ACE gene has also been shown to contribute to the development of some respiratory diseases. We hypothesize that the presence of ACE gene polymorphism can affect the outcome of ARDS. The objective of this proposed study is to determine the genotypes of ACE gene polymorphism and assess the influence of ACE genotype on the outcome and pulmonary resolution of patients with ARDS. Patients diagnosed to have ARDS are eligible for possible inclusion into the study. The ACE genotype of all patients with ARDS will be determined by polymerase chain reaction (PCR) amplification of the respective fragment for the D and I alleles from intron 16 of the ACE gene and size fractionation by electrophoresis. The outcome of patients with ARDS in the three genotypes will be compared.
Condition
Adult Respiratory Distress Syndrome

MedlinePlus related topics:  Respiratory Diseases

Study Type: Observational
Study Design: Natural History, Cross-Sectional, Random Sample, Retrospective/Prospective Study

Official Title: Polymorphism of the Angiotensin-Converting Enzyme Gene and the Outcome of Acute Respiratory Distress Syndrome

Further Study Details: 

Expected Total Enrollment:  250

Study start: December 2003;  Study completion: December 2004
Last follow-up: December 2004;  Data entry closure: December 2004

Study Design. This was a observational study of patients with ARDS. The study was reviewed and approved by the Institutional Review Board of the National Taiwan University Hospital. Patients admitted to the medical ICU at the National Taiwan University Hospital were screened for eligibility. Patients were considered eligible if they were over 18 years of age and fulfilled the American-European Consensus Committee criteria for ARDS: a) acute onset; b) bilateral pulmonary infiltrates; c) severely impaired oxygenation, i.e., PaO2/FIO2 < 200 mmHg; and d) pulmonary artery occlusion pressure < 18 mmHg or no evidence of left atrial hypertension (1).

Exclusion criteria were: a) a previous history of ARDS; b) received angiotensin-converting enzyme inhibitor or angiotensin receptor antagonist within one month before the development of ARDS; c) receiving mechanical ventilation due to chronic respiratory failure; and d) did not receive invasive mechanical ventilation after the occurrence of ARDS. If a patient had repeated episodes of ARDS during the study period, only the first episode would be studied and included for analysis. The diagnosis of sepsis was based on the criteria by the American College of Chest Physicians/Society of Critical Care Medicine Consensus Conference Committee (21).

In addition, two control groups, consisting “at-risk” patients and “non-at-risk”, respectively, were recruited for comparison. The patients in the “at-risk” group were all admitted to the MICU due to acute respiratory failure but did not meet the diagnostic criteria of ARDS throughout the hospital course. The “non-at-risk” group had no previous history of respiratory failure or admission to the ICU for any reason, and had not been hospitalized within 6 months before inclusion.

Clinical Data Collection and Outcome. For the ARDS and at-risk groups, the following data were collected on admission to the ICU: co-morbidities, Acute Physiology and Chronic Health Evaluation (APACHE II) scores (22), gender, age, and reason for admission. For the ARDS groups, the Lung Injury Scores (LIS) were measured at the time of diagnosis of ARDS(23). For the at-risk group, the highest lung LIS’s were also recorded. During the MICU admission, the best PaO2/FIO2 and the mode of mechanical ventilation were recorded daily and major organ functions (serum creatinine, blood cell and platelet counts, serum alanine aminotransferase) were regularly determined. Decisions on specific supportive treatments for ARDS (prone positioning, inhaled nitric oxide, high-frequency oscillation ventilation, etc.), weaning and extubation were determined by the attending physicians according to the clinical condition and test for eligibility of extubation. The primary outcome of this study was the survival at the 28th day of ARDS onset. The secondary outcome was the survival on hospital discharge.

ACE Polymorphism. After informed consents were obtained from the patients and control subjects, peripheral blood samples were obtained and enediaminetetraacetic acid (EDTA) was added. Genomic DNA was extracted using commercial kits (QIAamp DNA Blood Mini Kit, Qiagen, Valencia, CA) according to the manufacturer’s instructions and stored at -20˚C at a concentration of 100 ng/L until further genotyping studies. The ACE I/D genotypes were determined by PCR amplification of the respective fragments for the D and I alleles from intron 16 of the ACE gene and by size fractionation by electrophoresis as previously described elsewhere (24). Standard PCR was performed with 20 pmol of each primer (5’CTGGAGACCACTCCCATCCTTTCT3’ and 5’GATGTGGCCATCACATTCGTCAGAT3’) in a final volume of 25 L, containing 1.5 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl pH 8.3, 0.2 mM of each dNTP, and 1.25 units if Taq polymerase (Perkin Elmer-Cetus; Norwalk, Conn). The DNA was amplified for 30 cycles with denaturation at 94˚C for 30 s, annealing at 58˚C for 30 s, and extension at 72˚C for 1 min, followed by final extension at 72˚C for 5 min (DNA Thermal Cycler 480; Perkin Elmer-Cetus). The PCR products were electrophoresed in a 2% agarose gels with 5 g of ethidium bromide/mL, and were identified by 300-nm ultraviolet transillumination as distinct bands (D allele: 191 bp; I allele: 478 bp). Because of the concerns about mistyping ID as DD, all samples found to have the DD genotype were subjected to a second, independent PCR amplification with a primer pair that recognizes an insertion-specific sequence (5’TGGGACCACAGCGCCCGCCACTAC’3 and 5’TCGCCAGCCCTCCCATGCCCATAA’3) (25). The PCR condition has been described elsewhere(25). The reaction yields a 335-bp amplicon only in the presence of an I allele, and no product in samples homozygous for DD.

Statistical Analysis. The SPSS statistical package (version 10.1 for Windows; SPSS, Chicago, IL) was used for most of the statistical analyses. Continuous data were expressed as means  SD. Comparisons of the continuous data were performed by ANOVA or two-sample t tests. The chi-square tables were used to compare the observed number of each genotype with those expected for a population in a Hardy-Weinberg equilibrium and to compare genotype frequencies between the ARDS population and the control groups. The 28-day survival and survival on hospital discharge between the genotypes were estimated by the Kaplan-Meier method, and the statistical significances were tested using the log-rank test. Multivariate analyses for the primary and secondary outcomes were performed by the Cox proportional hazard methods. For all tests, a p value of 0.05 or less was considered significant.

Eligibility

Ages Eligible for Study:  18 Years and above,  Genders Eligible for Study:  Both

Accepts Healthy Volunteers

Criteria

Inclusion Criteria:

  • Patients with acute respiratory distress syndrome requiring intensive care and mechanical ventilation

Exclusion Criteria:

  • Pregnancy
  • History of previous acute respiratory distress syndrome
  • Chronic respiratory failure with ventilator use
  • Receiving angiotensin-converting enzyme inhibitors or angiotensin receptor blocker

Location Information


Taiwan
      National Taiwan University Hospital, Taipei,  Taiwan

Study chairs or principal investigators

Pan-Chyr Yang, MD, PhD,  Principal Investigator,  Department of Internal Medicine, National Taiwan University Hospital, Taipei, Taiwan   

More Information

Study ID Numbers:  9100207816
Last Updated:  September 9, 2005
Record first received:  September 9, 2005
ClinicalTrials.gov Identifier:  NCT00155779
Health Authority: Taiwan: Department of Health
ClinicalTrials.gov processed this record on 2005-09-13

Resources

  • ACE (Lab Tests Online)


[ Disclaimer: The information on GoldBamboo for any particular treatment, medicine, drug, or herbal product might be missing or incomplete, and should never be used as a single source of knowledge. GoldBamboo generally has links to authoritative sites displayed toward the bottom of each topic page under the heading "Resources". ]

Take control over your directory listings...INSTANTLY

Every day, thousands of users find businesses like yours in the GoldBamboo directory.

Limited Time Offer!!!

For only $30 a year, a savings of 70% off our standard rate:

  • Edit your listing (whenever you want!)
  • Link to your website
  • Choose which categories you are listed in
  • Describe your services

The process will take only a few minutes and consists of 3 easy steps:

1. Register     >     2. Edit Listings     >     3. Publish

Your Company
your street
yourtown, YS 12345
888-888-8888



No Thanks

Popular Treatments

Acne Treatment ADHD Treatment Allergy Treatment Alzheimer's Treatment
Anemia Treatment Arthritis Treatment Asthma Treatment Bipolar Disorder Treatment
Bird Flu Treatment Bladder Cancer Treatment Bladder Control Treatment Blood Pressure Treatment
Brain Tumor Treatment Breast Cancer Treatment Bronchitis Treatment Cancer Treatment
Cancer Alternative Treatment Cataract Treatment Cirrhosis Treatment Colitis Treatment
Colon Cancer Treatment Common Cold Treatment Conjunctivitis Treatment Constipation Treatment
Crohn's Disease Treatment Cystic Fibrosis Treatment Depression Treatment Dermatitis Treatment
Diabetes Treatment Edema Treatment Epilepsy Treatment Erectile Dysfunction Treatment
Fibromyalgia Treatment GERD Treatment Glaucoma Treatment Gout Treatment
Hay Fever Treatment Headache Treatment Heart Disease Treatment Hepatitis Treatment
High Blood Pressure Treatment High Cholesterol Treatment Hives Treatment Hypertension Treatment
Hypoglycemia Treatment IBS Treatment Impotence Treatment Indigestion Treatment
Infertility Treatment Influenza Treatment Insomnia Treatment Lactose Intolerance Treatment
Leukemia Treatment Lung Cancer Treatment Lyme Disease Treatment Macular Degeneration Treatment
Menopause Treatment Migraine Treatment Osteoarthritis Treatment Osteoporosis Treatment
Pancreatic Cancer Treatment PMS Treatment Pneumonia Treatment Prostate Diseases Treatment
Restless Leg Treatment Rheumatoid Arthritis Treatment Sepsis Treatment Sinusitis Treatment
Skin Cancer Treatment Sleep Apnea Treatment Snoring Treatment Stroke Treatment
Testicular Cancer Treatment
GoldBambooTM

Your Integrative Health and Wellness Resource for ACE.

November 28, 2009



Page Updated: June 1, 2005
============== Advertisement ==============
Disclaimer: All material displayed on the GoldBamboo.com website is provided for educational purposes only. Consult a physician regarding the applicability of any information found on GoldBamboo.com to your symptoms or medical condition.

Home | About Us | Link To Us | Feedback | Disclaimer | Privacy Policy | Terms of Use | Health Forums

Copyright © 2004-2009 - Anaconda Partners LLC - All rights reserved.

HONcode accreditation seal.

We comply with the HONcode standard for health trust worthy information:
verify here.